Review



plasmid 15476 plasmid prk5 myc empty vector dr  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Addgene inc plasmid 15476 plasmid prk5 myc empty vector dr
    Figure 4. Active mTORC1 Promotes Survival in Response to Mitotic Poisons (A) HeLa cells were transfected in triplicate with either <t>pRK5-myc</t> raptor WT or 8A mutant and synchronized using thymidine/nocodazole protocol, then labeled with [S35] methionine/cysteine, and the specific activity of incorporation into equal amounts of protein was determined by trichloroacetic acid (TCA) precipitation and scintillation counting. Data are expressed as means ± SEMs. Comparison was calculated using unpaired two-tailed Student’s t test (*p < 0.01). (B) Immunoblot analysis of HeLa cells that were transfected and synchronized as in (A). Nocodazole-arrested cells were collected and released into fresh media. Degradation of cyclin B1 and phosphorylation of cdc27 are used as markers for exit from mitosis. (C) The length of one whole cell cycle (between two mitoses) was measured for 50 cells (transfected with EGFP raptor WT or 8A) using time-lapse microscopy. Comparison was calculated using unpaired two-tailed Student’s t test (ns, p > 0.05). (D) HeLa cells were transfected with either EGFP-empty vector or Raptor WT or 8A mutant. Twenty-four hours following transfection, cells were synchronized by RO3306. After 20 h, cells were washed twice with PBS and released into fresh media containing either 100 nM Taxol (top panel) or 100 nM Taxol + 200 nM rapamycin, and time-lapse imaging was started. The length of time spent by 100 cells from mitotic entry until death was plotted. Mean death time is shown as a point estimate ± SEM and as a bar plot (right panel) for each treatment. Comparisons were calculated using one-way ANOVA with Bonferroni’s multiple com- parison tests (*p < 0.01; ns, p > 0.05).
    Plasmid 15476 Plasmid Prk5 Myc Empty Vector Dr, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+15476+plasmid+prk5+myc+empty+vector+dr/pRK5-myc-PRAS40+(Plasmid+%2315476)/pm33027666-273-47-46
    Average 93 stars, based on 6 article reviews
    plasmid 15476 plasmid prk5 myc empty vector dr - by Bioz Stars, 2026-09
    93/100 stars

    Images

    1) Product Images from "The mTORC1/S6K/PDCD4/eIF4A Axis Determines Outcome of Mitotic Arrest."

    Article Title: The mTORC1/S6K/PDCD4/eIF4A Axis Determines Outcome of Mitotic Arrest.

    Journal: Cell reports

    doi: 10.1016/j.celrep.2020.108230

    Figure 4. Active mTORC1 Promotes Survival in Response to Mitotic Poisons (A) HeLa cells were transfected in triplicate with either pRK5-myc raptor WT or 8A mutant and synchronized using thymidine/nocodazole protocol, then labeled with [S35] methionine/cysteine, and the specific activity of incorporation into equal amounts of protein was determined by trichloroacetic acid (TCA) precipitation and scintillation counting. Data are expressed as means ± SEMs. Comparison was calculated using unpaired two-tailed Student’s t test (*p < 0.01). (B) Immunoblot analysis of HeLa cells that were transfected and synchronized as in (A). Nocodazole-arrested cells were collected and released into fresh media. Degradation of cyclin B1 and phosphorylation of cdc27 are used as markers for exit from mitosis. (C) The length of one whole cell cycle (between two mitoses) was measured for 50 cells (transfected with EGFP raptor WT or 8A) using time-lapse microscopy. Comparison was calculated using unpaired two-tailed Student’s t test (ns, p > 0.05). (D) HeLa cells were transfected with either EGFP-empty vector or Raptor WT or 8A mutant. Twenty-four hours following transfection, cells were synchronized by RO3306. After 20 h, cells were washed twice with PBS and released into fresh media containing either 100 nM Taxol (top panel) or 100 nM Taxol + 200 nM rapamycin, and time-lapse imaging was started. The length of time spent by 100 cells from mitotic entry until death was plotted. Mean death time is shown as a point estimate ± SEM and as a bar plot (right panel) for each treatment. Comparisons were calculated using one-way ANOVA with Bonferroni’s multiple com- parison tests (*p < 0.01; ns, p > 0.05).
    Figure Legend Snippet: Figure 4. Active mTORC1 Promotes Survival in Response to Mitotic Poisons (A) HeLa cells were transfected in triplicate with either pRK5-myc raptor WT or 8A mutant and synchronized using thymidine/nocodazole protocol, then labeled with [S35] methionine/cysteine, and the specific activity of incorporation into equal amounts of protein was determined by trichloroacetic acid (TCA) precipitation and scintillation counting. Data are expressed as means ± SEMs. Comparison was calculated using unpaired two-tailed Student’s t test (*p < 0.01). (B) Immunoblot analysis of HeLa cells that were transfected and synchronized as in (A). Nocodazole-arrested cells were collected and released into fresh media. Degradation of cyclin B1 and phosphorylation of cdc27 are used as markers for exit from mitosis. (C) The length of one whole cell cycle (between two mitoses) was measured for 50 cells (transfected with EGFP raptor WT or 8A) using time-lapse microscopy. Comparison was calculated using unpaired two-tailed Student’s t test (ns, p > 0.05). (D) HeLa cells were transfected with either EGFP-empty vector or Raptor WT or 8A mutant. Twenty-four hours following transfection, cells were synchronized by RO3306. After 20 h, cells were washed twice with PBS and released into fresh media containing either 100 nM Taxol (top panel) or 100 nM Taxol + 200 nM rapamycin, and time-lapse imaging was started. The length of time spent by 100 cells from mitotic entry until death was plotted. Mean death time is shown as a point estimate ± SEM and as a bar plot (right panel) for each treatment. Comparisons were calculated using one-way ANOVA with Bonferroni’s multiple com- parison tests (*p < 0.01; ns, p > 0.05).

    Techniques Used: Transfection, Mutagenesis, Labeling, Activity Assay, TCA Precipitation, Comparison, Two Tailed Test, Western Blot, Phospho-proteomics, Time-lapse Microscopy, Plasmid Preparation, Imaging

    Related Articles

    Plasmid Preparation:

    Article Title: The mTORC1/S6K/PDCD4/eIF4A Axis Determines Outcome of Mitotic Arrest.
    Article Snippet: 50 TGGATGCTGGTGCTCAGTGGG30 This manuscript N/A qRT-PCR primer: 18S- forward 50GTAACCCGTTGAACCCCATT 30 This manuscript N/A qRT-PCR primer: 18S- reverse 50 CCATCCAATCGGTAGTAGCG 30 This manuscript N/A Recombinant DNA Plasmid: myc-Raptor wt (Sarbassov et al., 2004) Addgene Plasmid # #1859 Plasmid: myc-Raptor S722A/S792A. (Gwinn et al., 2008) Addgene Plasmid # #18118 (Continued on next page) e2 Cell Reports 33, 108230, October 6, 2020 .. REAGENT or RESOURCE SOURCE IDENTIFIER Plasmid: pcDNA3-Flag mTOR wt (Vilella-Bach et al., 1999) Addgene Plasmid # #26603 Plasmid: myc-mTOR (Sarbassov et al., 2004) Addgene Plasmid # #1861 Plasmid: pRK5 Flag PRAS40 (Sancak et al., 2007) Addgene Plasmid # #14950 Plasmid: pRK5-myc-PRAS40 (Vander Haar et al., 2007) Addgene Plasmid # #15476 Plasmid: pRK5- myc-empty vector Dr. .. I. Topisirovic Lab N/A Plasmid: pRK5- myc- Raptor S696A/T706A This manuscript N/A Plasmid: pRK5-myc- Raptor 3A This manuscript N/A Plasmid: pRK5-myc- Raptor 3A This manuscript N/A Plasmid: pRK5-myc- Raptor 3A* This manuscript N/A Plasmid: pRK5-myc- Raptor 6A This manuscript N/A Plasmid: pRK5-myc- Raptor 7A This manuscript N/A Plasmid: pRK5-myc- Raptor 7A* This manuscript N/A Plasmid: pRK5-myc- Raptor 8A This manuscript N/A Plasmid: pEGFPC1- Raptor wt This manuscript N/A Plasmid: pEGFPC1- Raptor 8A This manuscript N/A Software and Algorithms ImageJ- Version 1.53d (Schneider et al., 2012) https://imagej.nih.gov/ij/download.html GraphPad Prism 7 GraphPad software N/A SynergyFinder web application (version 2.0). (Ianevski et al., 2020) https://synergyfinder.fimm.fi/



    Similar Products

    plasmid 15476 plasmid prk5 myc empty vector dr  (Addgene inc)
    93
    Addgene inc plasmid 15476 plasmid prk5 myc empty vector dr
    Figure 4. Active mTORC1 Promotes Survival in Response to Mitotic Poisons (A) HeLa cells were transfected in triplicate with either <t>pRK5-myc</t> raptor WT or 8A mutant and synchronized using thymidine/nocodazole protocol, then labeled with [S35] methionine/cysteine, and the specific activity of incorporation into equal amounts of protein was determined by trichloroacetic acid (TCA) precipitation and scintillation counting. Data are expressed as means ± SEMs. Comparison was calculated using unpaired two-tailed Student’s t test (*p < 0.01). (B) Immunoblot analysis of HeLa cells that were transfected and synchronized as in (A). Nocodazole-arrested cells were collected and released into fresh media. Degradation of cyclin B1 and phosphorylation of cdc27 are used as markers for exit from mitosis. (C) The length of one whole cell cycle (between two mitoses) was measured for 50 cells (transfected with EGFP raptor WT or 8A) using time-lapse microscopy. Comparison was calculated using unpaired two-tailed Student’s t test (ns, p > 0.05). (D) HeLa cells were transfected with either EGFP-empty vector or Raptor WT or 8A mutant. Twenty-four hours following transfection, cells were synchronized by RO3306. After 20 h, cells were washed twice with PBS and released into fresh media containing either 100 nM Taxol (top panel) or 100 nM Taxol + 200 nM rapamycin, and time-lapse imaging was started. The length of time spent by 100 cells from mitotic entry until death was plotted. Mean death time is shown as a point estimate ± SEM and as a bar plot (right panel) for each treatment. Comparisons were calculated using one-way ANOVA with Bonferroni’s multiple com- parison tests (*p < 0.01; ns, p > 0.05).
    Plasmid 15476 Plasmid Prk5 Myc Empty Vector Dr, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+15476+plasmid+prk5+myc+empty+vector+dr/pRK5-myc-PRAS40+(Plasmid+%2315476)/pm33027666-273-47-46
    Average 93 stars, based on 1 article reviews
    plasmid 15476 plasmid prk5 myc empty vector dr - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier

    Image Search Results


    Figure 4. Active mTORC1 Promotes Survival in Response to Mitotic Poisons (A) HeLa cells were transfected in triplicate with either pRK5-myc raptor WT or 8A mutant and synchronized using thymidine/nocodazole protocol, then labeled with [S35] methionine/cysteine, and the specific activity of incorporation into equal amounts of protein was determined by trichloroacetic acid (TCA) precipitation and scintillation counting. Data are expressed as means ± SEMs. Comparison was calculated using unpaired two-tailed Student’s t test (*p < 0.01). (B) Immunoblot analysis of HeLa cells that were transfected and synchronized as in (A). Nocodazole-arrested cells were collected and released into fresh media. Degradation of cyclin B1 and phosphorylation of cdc27 are used as markers for exit from mitosis. (C) The length of one whole cell cycle (between two mitoses) was measured for 50 cells (transfected with EGFP raptor WT or 8A) using time-lapse microscopy. Comparison was calculated using unpaired two-tailed Student’s t test (ns, p > 0.05). (D) HeLa cells were transfected with either EGFP-empty vector or Raptor WT or 8A mutant. Twenty-four hours following transfection, cells were synchronized by RO3306. After 20 h, cells were washed twice with PBS and released into fresh media containing either 100 nM Taxol (top panel) or 100 nM Taxol + 200 nM rapamycin, and time-lapse imaging was started. The length of time spent by 100 cells from mitotic entry until death was plotted. Mean death time is shown as a point estimate ± SEM and as a bar plot (right panel) for each treatment. Comparisons were calculated using one-way ANOVA with Bonferroni’s multiple com- parison tests (*p < 0.01; ns, p > 0.05).

    Journal: Cell reports

    Article Title: The mTORC1/S6K/PDCD4/eIF4A Axis Determines Outcome of Mitotic Arrest.

    doi: 10.1016/j.celrep.2020.108230

    Figure Lengend Snippet: Figure 4. Active mTORC1 Promotes Survival in Response to Mitotic Poisons (A) HeLa cells were transfected in triplicate with either pRK5-myc raptor WT or 8A mutant and synchronized using thymidine/nocodazole protocol, then labeled with [S35] methionine/cysteine, and the specific activity of incorporation into equal amounts of protein was determined by trichloroacetic acid (TCA) precipitation and scintillation counting. Data are expressed as means ± SEMs. Comparison was calculated using unpaired two-tailed Student’s t test (*p < 0.01). (B) Immunoblot analysis of HeLa cells that were transfected and synchronized as in (A). Nocodazole-arrested cells were collected and released into fresh media. Degradation of cyclin B1 and phosphorylation of cdc27 are used as markers for exit from mitosis. (C) The length of one whole cell cycle (between two mitoses) was measured for 50 cells (transfected with EGFP raptor WT or 8A) using time-lapse microscopy. Comparison was calculated using unpaired two-tailed Student’s t test (ns, p > 0.05). (D) HeLa cells were transfected with either EGFP-empty vector or Raptor WT or 8A mutant. Twenty-four hours following transfection, cells were synchronized by RO3306. After 20 h, cells were washed twice with PBS and released into fresh media containing either 100 nM Taxol (top panel) or 100 nM Taxol + 200 nM rapamycin, and time-lapse imaging was started. The length of time spent by 100 cells from mitotic entry until death was plotted. Mean death time is shown as a point estimate ± SEM and as a bar plot (right panel) for each treatment. Comparisons were calculated using one-way ANOVA with Bonferroni’s multiple com- parison tests (*p < 0.01; ns, p > 0.05).

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Plasmid: pcDNA3-Flag mTOR wt (Vilella-Bach et al., 1999) Addgene Plasmid # #26603 Plasmid: myc-mTOR (Sarbassov et al., 2004) Addgene Plasmid # #1861 Plasmid: pRK5 Flag PRAS40 (Sancak et al., 2007) Addgene Plasmid # #14950 Plasmid: pRK5-myc-PRAS40 (Vander Haar et al., 2007) Addgene Plasmid # #15476 Plasmid: pRK5- myc-empty vector Dr.

    Techniques: Transfection, Mutagenesis, Labeling, Activity Assay, TCA Precipitation, Comparison, Two Tailed Test, Western Blot, Phospho-proteomics, Time-lapse Microscopy, Plasmid Preparation, Imaging